Mouse IFNGR2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008338.3

RefSeq ORF Size

999bp

Gene Synonym

Ifgt, Ifgr2, Ifngr2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse interferon gamma receptor 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferon gamma receptor beta chain (IFNgammaR2), also known as IFNGR2, belongs to the type II cytokine receptor family, whose deficiency is a cause of autosomal recessive mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2. IFNGR2 is a component of the IFNgamma receptor complex along with the IFNgammaR alpha chain (IFNGR1), and is a new Bax suppressor. The C-terminal fragment (cytoplasmic domain) of IFNgammaR2 is expressed in human cancer cell lines of megakaryocytic cancer (DAMI), breast cancer (MDA-MD-468), and prostate cancer (PC3 cells). The Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. IFNGR2 has always been seen as a key mechanism for shielding T lymphocytes from the antiproliferative effects of the IFNgamma-signal transducer and activator of transcription 1 (STAT1) pathway.

References

Gao PS, et al. (1999). Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels. Biochem Biophys Res Commun. 263(2): 425-9.

Regis G, et al. (2006). IFNgammaR2 trafficking tunes IFNgamma-STAT1 signaling in T lymphocytes. Trends Immunol. 27(2):96-101.

Al-Muhsen S, et al. (2008). The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol. 122 (6): 1043-51.

Gomez JA, et al. (2009). The C-terminus of interferon gamma receptor beta chain (IFNgammaR2) has antiapoptotic activity as a Bax inhibitor. Cancer Biol Ther. 8(18): 1771-86.

Catalog Number:MGD820-CY

IFNGR2 related areas, pathways, and other information