Mouse IFNGR2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGD820-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
999bp
Gene Synonym
Ifgt, Ifgr2, Ifngr2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interferon gamma receptor 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interferon gamma receptor beta chain (IFNgammaR2), also known as IFNGR2, belongs to the type II cytokine receptor family, whose deficiency is a cause of autosomal recessive mendelian susceptibility to mycobacterial disease (MSMD), also known as familial disseminated atypical mycobacterial infection. This accessory factor is an integral part of the IFN-gamma signal transduction pathway and is likely to interact with GAF, JAK1, and/or JAK2. IFNGR2 is a component of the IFNgamma receptor complex along with the IFNgammaR alpha chain (IFNGR1), and is a new Bax suppressor. The C-terminal fragment (cytoplasmic domain) of IFNgammaR2 is expressed in human cancer cell lines of megakaryocytic cancer (DAMI), breast cancer (MDA-MD-468), and prostate cancer (PC3 cells). The Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. IFNGR2 has always been seen as a key mechanism for shielding T lymphocytes from the antiproliferative effects of the IFNgamma-signal transducer and activator of transcription 1 (STAT1) pathway.
References
  • Gao PS, et al. (1999). Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels. Biochem Biophys Res Commun. 263(2): 425-9.
  • Regis G, et al. (2006). IFNgammaR2 trafficking tunes IFNgamma-STAT1 signaling in T lymphocytes. Trends Immunol. 27(2):96-101.
  • Al-Muhsen S, et al. (2008). The genetic heterogeneity of mendelian susceptibility to mycobacterial diseases. J Allergy Clin Immunol. 122 (6): 1043-51.
  • Gomez JA, et al. (2009). The C-terminus of interferon gamma receptor beta chain (IFNgammaR2) has antiapoptotic activity as a Bax inhibitor. Cancer Biol Ther. 8(18): 1771-86.
  •  

    IFNGR2 related areas, pathways, and other information

    TOP