Mouse ICOSL/ICOS ligand/B7-h2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_015790.3

RefSeq ORF Size

969bp

Gene Synonym

B7h, GI50, GL50, B7-H2, LICOS, B7RP-1, GL50-B, ICOS-L, Icoslg, Ly115l, AU044799, BG071784, KIAA0653, mKIAA0653, Icosl

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse icos ligand Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.

References

Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.

Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.

Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.

Catalog Number:MGD784-CO