Mouse ICOSL/ICOS ligand/B7-h2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD784-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
969bp
Gene Synonym
B7h, GI50, GL50, B7-H2, LICOS, B7RP-1, GL50-B, ICOS-L, Icoslg, Ly115l, AU044799, BG071784, KIAA0653, mKIAA0653, Icosl
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse icos ligand Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.
References
  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.
  • TOP