Mouse HPGD/15-PGDH Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD701-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
810bp
Gene Synonym
15-PGDH, AV026552, MGC14001, Hpgd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse hydroxyprostaglandin dehydrogenase 15 (NAD) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.
References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • TOP