Mouse HPGD/15-PGDH Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGD701-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
810bp
Gene Synonym
15-PGDH, AV026552, MGC14001, Hpgd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse hydroxyprostaglandin dehydrogenase 15 (NAD) Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.
References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • TOP