Human HBP1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGD494-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545bp
Gene Synonym
FLJ16340, HBP1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human HMG-box transcription factor 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.
References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
  • TOP