Human HBP1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGD494-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545bp
Gene Synonym
FLJ16340, HBP1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human HMG-box transcription factor 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.
References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
  • TOP