Human GSTK1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC001231

RefSeq ORF Size

681bp

Gene Synonym

HDCMD47P, GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1, GSTK1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human glutathione S-transferase kappa 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GSTK1 gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic, xenobiotic substrates, thus aiding excretion from the body. GSTK1(glutathione S-transferase kappa 1) is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. GSTK1 functions in cellular detoxification.

References

Zhang QH, et al. (2001) Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res. 10(10):1546-60.

Morel F, et al. (2004) Gene and protein characterization of the human glutathione S-transferase kappa and evidence for a peroxisomal localization. J Biol Chem. 279(16): 16246-53.

Jowsey IR, et al. (2003) Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem J. 373(Pt 2):559-69.

Catalog Number:MGD319-NY