Human GSTK1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGD319-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681bp
Gene Synonym
HDCMD47P, GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1, GSTK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glutathione S-transferase kappa 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GSTK1 gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic, xenobiotic substrates, thus aiding excretion from the body. GSTK1(glutathione S-transferase kappa 1) is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. GSTK1 functions in cellular detoxification.
References
  • Zhang QH, et al. (2001) Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res. 10(10):1546-60.
  • Morel F, et al. (2004) Gene and protein characterization of the human glutathione S-transferase kappa and evidence for a peroxisomal localization. J Biol Chem. 279(16): 16246-53.
  • Jowsey IR, et al. (2003) Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem J. 373(Pt 2):559-69.
  • TOP