Mouse Glypican 3/GPC3/OCI-5 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_016697.3

RefSeq ORF Size

1740bp

Gene Synonym

OCI-5, Gpc3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse glypican 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.

References

Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.

Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.

Catalog Number:MGD153-CY