Mouse Glypican 3/GPC3/OCI-5 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGD153-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1740bp
Gene Synonym
OCI-5, Gpc3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glypican 3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.
References
  • Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.
  • Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.
  • TOP