Rat GGT1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD095-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1707bp
Gene Synonym
Ggt, Ggtp, GGLUT, RATGGLUT, Ggt1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat gamma-glutamyltransferase 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.
References
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.
  • TOP