Rat GGT1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGD095-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1707bp
Gene Synonym
Ggt, Ggtp, GGLUT, RATGGLUT, Ggt1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat gamma-glutamyltransferase 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.
References
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.
  • TOP