Mouse GAD65 / GAD2 / GAD-2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGC984-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1758bp
Gene Synonym
GAD65, Gad-2, GAD(65), 6330404F12Rik, Gad2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse glutamic acid decarboxylase 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and GAD65, is a member of the group II decarboxylase family. GAD2 is identified as a major autoantigen in insulin-dependent diabetes. GAD2 is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. GAD2 may also play a role in the stiff man syndrome. GAD2 is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. GABA is synthesized in brain by two isoforms of glutamic acid decarboxylase (Gad), GAD1 and GAD2. GAD1 provides most of the GABA in brain, but GAD2 can be rapidly activated in times of high GABA demand. Mice lacking GAD2 are viable whereas deletion of GAD1 is lethal. Deletion of GAD2 increased ethanol palatability and intake and slightly reduced the severity of ethanol-induced withdrawal.
References
TOP