Mouse GAD65 / GAD2 / GAD-2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008078.2

RefSeq ORF Size

1758bp

Gene Synonym

GAD65, Gad-2, GAD(65), 6330404F12Rik, Gad2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse glutamic acid decarboxylase 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and GAD65, is a member of the group II decarboxylase family. GAD2 is identified as a major autoantigen in insulin-dependent diabetes. GAD2 is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. GAD2 may also play a role in the stiff man syndrome. GAD2 is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. GABA is synthesized in brain by two isoforms of glutamic acid decarboxylase (Gad), GAD1 and GAD2. GAD1 provides most of the GABA in brain, but GAD2 can be rapidly activated in times of high GABA demand. Mice lacking GAD2 are viable whereas deletion of GAD1 is lethal. Deletion of GAD2 increased ethanol palatability and intake and slightly reduced the severity of ethanol-induced withdrawal.

References

Catalog Number:MGC984-CO