Mouse Frizzled-5/FZD5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001042659.1

RefSeq ORF Size

1758bp

Gene Synonym

Fz5, Fz-5, mFz5, AI427138, MGC141642, 5330434N09Rik, Fzd5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 10 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt10B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.

References

Catalog Number:MGC908-NY