Mouse Frizzled-5/FZD5 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGC908-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1758bp
Gene Synonym
Fz5, Fz-5, mFz5, AI427138, MGC141642, 5330434N09Rik, Fzd5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila) Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 10 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt10B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.
References
TOP