Mouse FLT3L / Flt3 ligand Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC872-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
Ly72L, Flt3lg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse FMS-like tyrosine kinase 3 ligand Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
KpnI + XbaI (6kb + 0.71kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases the number of immune cells by activating the hematopoietic progenitors. In vivo, FLT3L also induces the mobilization of the hematopoietic progenitors and stem cells. This may help the system to kill cancer cells. Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3L controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 -positive classical DCs and their CD103 -positive tissue counterparts.
References
  • Hannum C, et al. (1994) Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368 (6472): 643-8.
  • Lyman SD, et al. (1995) Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs. Oncogene 10 (1): 149-57.
  • Lyman SD, et al. (1994) Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75 (6): 1157-67.
  • TOP