Mouse FLT3L / Flt3 ligand Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGC872-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
Ly72L, Flt3lg
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse FMS-like tyrosine kinase 3 ligand Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + XbaI (6kb + 0.71kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases the number of immune cells by activating the hematopoietic progenitors. In vivo, FLT3L also induces the mobilization of the hematopoietic progenitors and stem cells. This may help the system to kill cancer cells. Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3L controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 -positive classical DCs and their CD103 -positive tissue counterparts.
References
  • Hannum C, et al. (1994) Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368 (6472): 643-8.
  • Lyman SD, et al. (1995) Identification of soluble and membrane-bound isoforms of the murine flt3 ligand generated by alternative splicing of mRNAs. Oncogene 10 (1): 149-57.
  • Lyman SD, et al. (1994) Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell 75 (6): 1157-67.
  • TOP