Mouse FACTOR D/Adipsin Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGC640-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
777bp
Gene Synonym
DF, Adn, Cfd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement factor D (adipsin) Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.
References
  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.
  • TOP