Mouse FACTOR D/Adipsin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGC640-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
777bp
Gene Synonym
DF, Adn, Cfd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse complement factor D (adipsin) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.
References
  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.
  • TOP