Mouse Epidermal Growth Factor/EGF Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010113.3

RefSeq ORF Size

3654bp

Gene Synonym

AI790464

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse epidermal growth factor Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar structural and functional characteristics. EGF contains 9 EGF-like domains and 9 LDL-receptor class B repeats. Human EGF is a 6045-Da protein with 53 amino acid residues and three intramolecular disulfide bonds. As a low-molecular-weight polypeptide, EGF was first purified from the mouse submandibular gland, but since then it was found in many human tissues including submandibular gland, parotid gland. It can also be found in human platelets, macrophages, urine, saliva, milk, and plasma. EGF is a growth factor that stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. It results in cellular proliferation, differentiation, and survival. Salivary EGF, which seems also regulated by dietary inorganic iodine, also plays an important physiological role in the maintenance of oro-esophageal and gastric tissue integrity. EGF acts by binding with high affinity to epidermal growth factor receptor on the cell surface and stimulating the intrinsic protein-tyrosine kinase activity of the receptor. The tyrosine kinase activity, in turn, initiates a signal transduction cascade that results in a variety of biochemical changes within the cell - a rise in intracellular calcium levels, increased glycolysis and protein synthesis, and increases in the expression of certain genes including the gene for EGFR - that ultimately lead to DNA synthesis and cell proliferation.

References

Chen JX, et al. (2011) Involvement of c-Src/STAT3 signal in EGF-induced proliferation of rat spermatogonial stem cells. Mol Cell Biochem. 358(1-2):67-73.

Guo Y, et al. (2012) Correlations among ERCC1, XPB, UBE2I, EGF, TAL2 and ILF3 revealed by gene signatures of histological subtypes of patients with epithelial ovarian cancer. Oncol Rep. 27(1):286-92.

Kim S, et al. (2012) Smad7 acts as a negative regulator of the epidermal growth factor (EGF) signaling pathway in breast cancer cells. Cancer Lett. 314(2):147-54.

Chatterton RT Jr, et al. (2010) Breast ductal lavage for assessment of breast cancer biomarkers. Horm Cancer. 1(4):197-204.

Catalog Number:MGC555-NM