Mouse DDOST/OST48 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007838.2

RefSeq ORF Size

1326bp

Gene Synonym

Ddost

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse dolichyl-di-phosphooligosaccharide-protein glycotransferase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts a typical type I membrane topology, containing a large luminal domain, a hydrophobic transmembrane domain and a short cytosolic peptide tail. DDOST/OST48 catalyzes the transfer of a high-mannose oligosaccharide (GlcNac2Man9Glc3) from a dolichol-linked oligosaccharide donor (dolichol-P-GlcNac2Man9Glc3) onto the asparagine acceptor site within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains across the membrane of the endoplasmic reticulum. The mammalian oligosaccharyltransferase (OST) is an oligomeric complex composed of three type I transmembrane proteins of the endoplasmic reticulum: ribophorin I (RI), ribophorin II (RII), and OST48. OST48 is not a glycoprotein and is not recognized by antibodies to either ribophorin. Like ribophorins I and II, OST48 was found to be an integral membrane protein, with the majority of the polypeptide located within the lumen of the endoplasmic reticulum (ER). OST48 does not show significant amino acid sequence homology to either ribophorin I or II. It had been found that only the luminal domain of RI contains ER retention information. The dilysine motif in OST48 functions as an ER localization motif because OST48 in which the two lysine residues are replaced by serine (OST48ss) is no longer retained in the ER and is found instead also at the plasma membrane.

References

Silberstein S, et al. (1992) The 48-kDa subunit of the mammalian oligosaccharyltransferase complex is homologous to the essential yeast protein WBP1. J Biol Chem. 267(33): 23658-63.

Fu J, et al. (1997) Interactions among subunits of the oligosaccharyltransferase complex. J Biol Chem. 272(47): 29687-92.

Yamagata T, et al. (1997) Genomics. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). 45(3): 535-40.

Fu J, et al. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J Biol Chem. 275(6): 3984-90.

Hardt B, et al. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol Chem. 382(7): 1039-47.

Catalog Number:MGC114-NM