Mouse DDOST/OST48 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGC114-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1326bp
Gene Synonym
Ddost
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse dolichyl-di-phosphooligosaccharide-protein glycotransferase Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts a typical type I membrane topology, containing a large luminal domain, a hydrophobic transmembrane domain and a short cytosolic peptide tail. DDOST/OST48 catalyzes the transfer of a high-mannose oligosaccharide (GlcNac2Man9Glc3) from a dolichol-linked oligosaccharide donor (dolichol-P-GlcNac2Man9Glc3) onto the asparagine acceptor site within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains across the membrane of the endoplasmic reticulum. The mammalian oligosaccharyltransferase (OST) is an oligomeric complex composed of three type I transmembrane proteins of the endoplasmic reticulum: ribophorin I (RI), ribophorin II (RII), and OST48. OST48 is not a glycoprotein and is not recognized by antibodies to either ribophorin. Like ribophorins I and II, OST48 was found to be an integral membrane protein, with the majority of the polypeptide located within the lumen of the endoplasmic reticulum (ER). OST48 does not show significant amino acid sequence homology to either ribophorin I or II. It had been found that only the luminal domain of RI contains ER retention information. The dilysine motif in OST48 functions as an ER localization motif because OST48 in which the two lysine residues are replaced by serine (OST48ss) is no longer retained in the ER and is found instead also at the plasma membrane.
References
  • Silberstein S, et al. (1992) The 48-kDa subunit of the mammalian oligosaccharyltransferase complex is homologous to the essential yeast protein WBP1. J Biol Chem. 267(33): 23658-63.
  • Fu J, et al. (1997) Interactions among subunits of the oligosaccharyltransferase complex. J Biol Chem. 272(47): 29687-92.
  • Yamagata T, et al. (1997) Genomics. Genome organization of human 48-kDa oligosaccharyltransferase (DDOST). 45(3): 535-40.
  • Fu J, et al. (2000) Retention of subunits of the oligosaccharyltransferase complex in the endoplasmic reticulum. J Biol Chem. 275(6): 3984-90.
  • Hardt B, et al. (2001) Analysis of structural signals conferring localisation of pig OST48 to the endoplasmic reticulum. Biol Chem. 382(7): 1039-47.
  • TOP