Mouse CXCL4 / PF4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGB946-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
318bp
Gene Synonym
Cxcl4, Scyb4, Pf4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse platelet factor 4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the CXC chemokine family. CXCL4/PF4 is released from the alpha-granules of activated platelets and binds with high affinity to heparin. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, CXCL4/PF4 probably has a role in inflammation and wound repair. This protein is released during platelet aggregation. CXCL4/PF4 neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. CXCL4 is chemotactic for neutrophils and monocytes. It inhibits endothelial cell proliferation, the short form is a more potent inhibitor than the longer form. CXCL4/PF4 is up-regulated in human liver fibrosis and that it plays a nonredundant, functional role in experimental liver fibrosis by mediating stellate cell proliferation, migration, and intrahepatic immune cell recruitment.
References
  • Zaldivar MM, et al. (2010) CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 51(4): 1345-53.
  • Lasagni L, et al. (2007) PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion. Blood. 109(10): 4127-34.
  • Struyf S, et al. (2004) Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 95(9): 855-7.
  • TOP