Mouse CXCL4 / PF4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_019932.4

RefSeq ORF Size

318bp

Gene Synonym

Cxcl4, Scyb4, Pf4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse platelet factor 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the CXC chemokine family. CXCL4/PF4 is released from the alpha-granules of activated platelets and binds with high affinity to heparin. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, CXCL4/PF4 probably has a role in inflammation and wound repair. This protein is released during platelet aggregation. CXCL4/PF4 neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. CXCL4 is chemotactic for neutrophils and monocytes. It inhibits endothelial cell proliferation, the short form is a more potent inhibitor than the longer form. CXCL4/PF4 is up-regulated in human liver fibrosis and that it plays a nonredundant, functional role in experimental liver fibrosis by mediating stellate cell proliferation, migration, and intrahepatic immune cell recruitment.

References

Zaldivar MM, et al. (2010) CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 51(4): 1345-53.

Lasagni L, et al. (2007) PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion. Blood. 109(10): 4127-34.

Struyf S, et al. (2004) Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 95(9): 855-7.

Catalog Number:MGB946-CF