Rat COMMD9 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001033692.1

RefSeq ORF Size

597bp

Gene Synonym

Commd9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat COMM domain containing 9 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

References

Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.

Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.

Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.

Catalog Number:MGB753-NF