Rat COMMD9 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001033692.1

RefSeq ORF Size

597bp

Gene Synonym

Commd9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat COMM domain containing 9 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

References

Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.

Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.

Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.

Catalog Number:MGB753-CY