Mouse CNDP1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_177450.4

RefSeq ORF Size

1479bp

Gene Synonym

Cn1, AI746433, Cndp1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse carnosine dipeptidase 1 (metallopeptidase M20 family) Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CNDP1, also known as carnosine dipeptidase 1, glutamate carboxypeptidase-like protein 2 (CPGL-2) or carnosinase 1 (CN1), is a member of the M20 metalloprotease family. The CNDP1 gene contains trinucleotide (CTG) repeat length polymorphism in the coding region, which has been demonstrated to be associated with susceptibility to developing diabetic nephropathy, for carnosine protection against the adverse effects of high glucose levels on renal cells. In humans, CNDP1 is secreted from the liver into the serum. In other mammals, including rodents, CNDP1 is expressed exclusively within the kidney and lacks a signal peptide. CNDP1 protein is a secreted homodimeric dipeptidase that specifically hydrolyzes L-carnosine (β-alanyl-L-histidine), and is identified as human carnosinase expressed in the brain. CNDP1 has been associated with diabetic nephropathy in Europeans and European Americans, but not African-Americans. It was identified and confirmed as a risk factor, were cross-sectional and mostly in patients with type 2 diabetes. The polymorphisms of CNDP1 can be excluded as a risk factor for nephropathy in type 1 diabetes. In addition, CNDP1 is also suggested to be implicated in the actions of neuroprotection and neurotransmiting.

References

Teufel M, et al. (2003) Sequence identification and characterization of human carnosinase and a closely related non-specific dipeptidase. J Biol Chem 278(8):6521-31.

Janssen B, et al. (2005) Carnosine as a protective factor in diabetic nephropathy: association with a leucine repeat of the carnosinase gene CNDP1. Diabetes 54(8):2320-7.

Riedl E, et al. (2007) A CTG polymorphism in the CNDP1 gene determines the secretion of serum carnosinase in Cos-7 transfected cells. Diabetes 56(9):2410-3.

Freedman BI, et al. (2007) A leucine repeat in the carnosinase gene CNDP1 is associated with diabetic end-stage renal disease in European Americans. Nephrol Dial Transplant 22(4):1131-5.

Wanic K, et al. (2008) Exclusion of polymorphisms in carnosinase genes (CNDP1 and CNDP2) as a cause of diabetic nephropathy in type 1 diabetes: results of large case-control and follow-up studies. Diabetes 57(9):2547-51.

McDonough CW, et al. (2009) The influence of carnosinase gene polymorphisms on diabetic nephropathy risk in African-Americans. Hum Genet. 126(2):265-75.

Catalog Number:MGB688-CO