Mouse CNDP1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_177450.4

RefSeq ORF Size

1479bp

Gene Synonym

Cn1, AI746433, Cndp1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse carnosine dipeptidase 1 (metallopeptidase M20 family) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CNDP1, also known as carnosine dipeptidase 1, glutamate carboxypeptidase-like protein 2 (CPGL-2) or carnosinase 1 (CN1), is a member of the M20 metalloprotease family. The CNDP1 gene contains trinucleotide (CTG) repeat length polymorphism in the coding region, which has been demonstrated to be associated with susceptibility to developing diabetic nephropathy, for carnosine protection against the adverse effects of high glucose levels on renal cells. In humans, CNDP1 is secreted from the liver into the serum. In other mammals, including rodents, CNDP1 is expressed exclusively within the kidney and lacks a signal peptide. CNDP1 protein is a secreted homodimeric dipeptidase that specifically hydrolyzes L-carnosine (β-alanyl-L-histidine), and is identified as human carnosinase expressed in the brain. CNDP1 has been associated with diabetic nephropathy in Europeans and European Americans, but not African-Americans. It was identified and confirmed as a risk factor, were cross-sectional and mostly in patients with type 2 diabetes. The polymorphisms of CNDP1 can be excluded as a risk factor for nephropathy in type 1 diabetes. In addition, CNDP1 is also suggested to be implicated in the actions of neuroprotection and neurotransmiting.

References

Teufel M, et al. (2003) Sequence identification and characterization of human carnosinase and a closely related non-specific dipeptidase. J Biol Chem 278(8):6521-31.

Janssen B, et al. (2005) Carnosine as a protective factor in diabetic nephropathy: association with a leucine repeat of the carnosinase gene CNDP1. Diabetes 54(8):2320-7.

Riedl E, et al. (2007) A CTG polymorphism in the CNDP1 gene determines the secretion of serum carnosinase in Cos-7 transfected cells. Diabetes 56(9):2410-3.

Freedman BI, et al. (2007) A leucine repeat in the carnosinase gene CNDP1 is associated with diabetic end-stage renal disease in European Americans. Nephrol Dial Transplant 22(4):1131-5.

Wanic K, et al. (2008) Exclusion of polymorphisms in carnosinase genes (CNDP1 and CNDP2) as a cause of diabetic nephropathy in type 1 diabetes: results of large case-control and follow-up studies. Diabetes 57(9):2547-51.

McDonough CW, et al. (2009) The influence of carnosinase gene polymorphisms on diabetic nephropathy risk in African-Americans. Hum Genet. 126(2):265-75.

Catalog Number:MGB688-CF