Mouse CLK3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007713.4

RefSeq ORF Size

1917bp

Gene Synonym

AI256811

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CDC-like kinase 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC Ser/Thr protein kinase family and Lammer subfamily. Mammalian CLK is the prototype for a family of dual specificity kinases (termed Lammer kinases) that have been conserved in evolution. CLK family members have shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. The three members of the CLK family of kinases (CLK1, CLK2, and CLK3) have been shown to undergo conserved alternative splicing to generate catalytically active and inactive isoforms. The human CLK2 and CLK3 are found within the nucleus and display dual-specificity kinase activity. The truncated isoforms, hCLK2(T) and hCLK3(T), colocalize with SR proteins in nuclear speckles. CLK3 may play a role in the development and progression of azoospermia.

References

Duncan, PI. et al., 1998, Exp. Cell Res. 241: 300 - 8.

Menegay, H. et al., 1999, Exp Cell Res. 253 (2): 463-73.

García-Sacristán, A. et al., 2005, Cell Res. 15 (7): 495-503.

Bullock, AN. et al., 2009, Structure 17 (3): 352-62.

Catalog Number:MGB656-CY