Mouse CLK3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007713.4

RefSeq ORF Size

1917bp

Gene Synonym

AI256811

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CDC-like kinase 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC Ser/Thr protein kinase family and Lammer subfamily. Mammalian CLK is the prototype for a family of dual specificity kinases (termed Lammer kinases) that have been conserved in evolution. CLK family members have shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. The three members of the CLK family of kinases (CLK1, CLK2, and CLK3) have been shown to undergo conserved alternative splicing to generate catalytically active and inactive isoforms. The human CLK2 and CLK3 are found within the nucleus and display dual-specificity kinase activity. The truncated isoforms, hCLK2(T) and hCLK3(T), colocalize with SR proteins in nuclear speckles. CLK3 may play a role in the development and progression of azoospermia.

References

Duncan, PI. et al., 1998, Exp. Cell Res. 241: 300 - 8.

Menegay, H. et al., 1999, Exp Cell Res. 253 (2): 463-73.

García-Sacristán, A. et al., 2005, Cell Res. 15 (7): 495-503.

Bullock, AN. et al., 2009, Structure 17 (3): 352-62.

Catalog Number:MGB656-CM