Rat CLEC10A/MGL1/CD301 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGB632-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
921bp
Gene Synonym
Mgl, Mgl1, Mgll, Clec10a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat C-type lectin domain family 10, member A Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.
References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • TOP