Rat CLEC10A/MGL1/CD301 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB632-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
921bp
Gene Synonym
Mgl, Mgl1, Mgll, Clec10a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat C-type lectin domain family 10, member A Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.
References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • TOP