Mouse CHST3/C6ST-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_016803.2

RefSeq ORF Size

1419bp

Gene Synonym

C6ST, GST-0, C6ST-1, Chst3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbohydrate sulfotransferase 3, also known as Chondroitin 6-O-sulfotransferase 1, Chondroitin 6-sulfotransferase and CHST3, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family and Gal / GlcNAc / GalNAc subfamily. CHST3 is widely expressed in adult tissues. It is expressed in heart, placenta, skeletal muscle and pancreas. CHST3 is also expressed in various immune tissues such as spleen, lymph node, thymus and appendix. CHST3 catalyzes the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. It is a chondroitin sulfate which constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. It can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. It may play a role in the maintenance of naive T-lymphocytes in the spleen. Defects in CHST3 are the cause of spondyloepiphyseal dysplasia Omani type (SED Omani type) which is an autosomal recessive disorder characterized by normal length at birth but severely reduced adult height (110-130 cm), severe progressive kyphoscoliosis, arthritic changes with joint dislocations, genu valgum, cubitus valgus, mild brachydactyly, camptodactyly, microdontia and normal intelligence. As a consequence of the arthropathy and the contractures, affected individuals develop restricted joint movement. Defects in CHST3 are also a cause of humerospinal dysostosis (HSD) which is characterized by bifurcation of the ends of the humerus, subluxation in the elbow joints, widened iliac bones, talipes equinovarus and coronal cleft vertebrae. Congenital, progressive heart disease, possibly with fatal outcome, is observed in some patients.

References

Fukuta M., et al., 1998, Biochim. Biophys. Acta 1399:57-61.

Tsutsumi K., et al., 1998, FEBS Lett. 441:235-241.

Thiele H., et al., 2004, Proc. Natl. Acad. Sci. USA. 101:10155-10160.

Hermanns P., et al., 2008, Am. J. Hum. Genet. 82:1368-1374.

Catalog Number:MGB579-NF