Mouse CHST3/C6ST-1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGB579-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1419bp
Gene Synonym
C6ST, GST-0, C6ST-1, Chst3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse carbohydrate (chondroitin 6/keratan) sulfotransferase 3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carbohydrate sulfotransferase 3, also known as Chondroitin 6-O-sulfotransferase 1, Chondroitin 6-sulfotransferase and CHST3, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family and Gal / GlcNAc / GalNAc subfamily. CHST3 is widely expressed in adult tissues. It is expressed in heart, placenta, skeletal muscle and pancreas. CHST3 is also expressed in various immune tissues such as spleen, lymph node, thymus and appendix. CHST3 catalyzes the transfer of sulfate to position 6 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. It is a chondroitin sulfate which constitutes the predominant proteoglycan present in cartilage and is distributed on the surfaces of many cells and extracellular matrices. It can also sulfate Gal residues of keratan sulfate, another glycosaminoglycan, and the Gal residues in sialyl N-acetyllactosamine (sialyl LacNAc) oligosaccharides. It may play a role in the maintenance of naive T-lymphocytes in the spleen. Defects in CHST3 are the cause of spondyloepiphyseal dysplasia Omani type (SED Omani type) which is an autosomal recessive disorder characterized by normal length at birth but severely reduced adult height (110-130 cm), severe progressive kyphoscoliosis, arthritic changes with joint dislocations, genu valgum, cubitus valgus, mild brachydactyly, camptodactyly, microdontia and normal intelligence. As a consequence of the arthropathy and the contractures, affected individuals develop restricted joint movement. Defects in CHST3 are also a cause of humerospinal dysostosis (HSD) which is characterized by bifurcation of the ends of the humerus, subluxation in the elbow joints, widened iliac bones, talipes equinovarus and coronal cleft vertebrae. Congenital, progressive heart disease, possibly with fatal outcome, is observed in some patients.
References
  • Fukuta M., et al., 1998, Biochim. Biophys. Acta 1399:57-61.
  • Tsutsumi K., et al., 1998, FEBS Lett. 441:235-241.
  • Thiele H., et al., 2004, Proc. Natl. Acad. Sci. USA. 101:10155-10160.
  • Hermanns P., et al., 2008, Am. J. Hum. Genet. 82:1368-1374.
  • TOP