Mouse Chk1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007691.4

RefSeq ORF Size

1431bp

Gene Synonym

Chk1, rad27, C85740, Chek1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse checkpoint kinase 1 homolog (S. pombe) Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.

References

Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.

Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.

Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.

Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.

Catalog Number:MGB547-NO