Mouse Chk1 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:MGB547-CG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1431bp
Gene Synonym
Chk1, rad27, C85740, Chek1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse checkpoint kinase 1 homolog (S. pombe) Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family, NIM1 subfamily. It is a member of checkpoint kinases (Chks). Chks Checkpoint kinases (Chks) are serine/threonine kinases that are involved in the control of the cell cycle. There are two subtypes of chks that have so far been identified, CHK1 / CHEK1 and Chk2. They are essential components to delay cell cycle progression in normal and damaged cells and can act at all three cell cycle checkpoints. Chks are activated by phosphorylation. ATR kinase phosphorylates CHK1 / CHEK1 in response to single strand DNA breaks and ATM kinase phosphorylates Chk2 in response to double strand breaks. Chks phosphorylate Cdc25 phosphatase at Ser216, which leads to Cdc25 sequestration in the cytoplasm. Chks have a role in the physiological stress of hypoxia/reoxygenation. CHK1 / CHEK1 is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. CHK1 / CHEK1 may also negatively regulate cell cycle progression during unperturbed cell cycles.
References
  • Chen P, et al. (2000) The 1.7 a crystal structure of human cell cycle checkpoint kinase CHK1 / CHEK1: Implications for CHK1 / CHEK1 regulation. Cell. 100 (6): 681-92.
  • Sanchez Y, et al. (1997) Conservation of the CHK1 / CHEK1 checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science. 277 (5331): 1497-501.
  • Flaggs G, et al. (1998) Atm-dependent interactions of a mammalian CHK1 / CHEK1 homolog with meiotic chromosomes. Curr Biol. 7 (12): 977-86.
  • Chini CC, et al. (2005) Claspin, a regulator of CHK1 / CHEK1 in DNA replication stress pathway. DNA Repair. 3 (8-9): 1033-7.
  • TOP