Mouse CES2/Carboxylesterase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB515-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1686bp
Gene Synonym
ces2A3, Ces2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse carboxylesterase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.
References
  • Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.
  • Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.
  • Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.
  • TOP