Mouse CES2/Carboxylesterase 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_145603.1

RefSeq ORF Size

1686bp

Gene Synonym

ces2A3, Ces2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse carboxylesterase 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family. Carboxylesterase 2 is responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and beroin. It also serves to hydrolyze long-chain fatty acid esters and thioesters. It is speculated that carboxylesterases may play a role in lipid metabolism and the blood-brain barrier system and together with isform 1, are a serine esterase involved in both drug metabolism and activation. Human carboxylesterase 2 is commonly expressed in tumor tissues and irinotecan, a topoisomerase I inhibitor commonly used in the treatment of many solid tumors.

References

Imai T. et al. (2006) Human carboxylesterase isozymes: catalytic properties and rational drug design. Drug metab pharmacokinet. 21 (3): 173-85.

Guang Xu, et al. (2002) Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clin Cancer Res. 8: 2605.

Zhang, et al. (2002) Comprehensive Evaluation of Carboxylesterase-2 Expression in Normal Human Tissues Using Tissue Array Analysis. Applied Immunohistochemistry & Molecular Morphology. 10 (4): 374-80.

Catalog Number:MGB515-CY