Mouse CD200R4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_207244.2

RefSeq ORF Size

813bp

Gene Synonym

MCD200RLa, F630107N04Rik, Cd200r4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CD200 receptor 4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cell surface glycoprotein CD200 receptor 4, also known as Cell surface glycoprotein OX2 receptor 4, CD200 cell surface glycoprotein receptor-like 4, CD200RLa, and CD200R4, is a single-pass type I membrane protein which belongs to the CD200R family. CD200 (OX2) is a cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed mainly on myeloid cells and is involved in regulation of macrophage and mast cell function. In mouse there are up to five genes related to CD200R with conflicting data as to whether they bind CD200. CD200R4 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200R4 is highly expressed in monocytes, NK cells and a subset of NKT cells. It is weakly expressed in granulocytes and B cells (at protein level). CD200R4 is also expressed in brain, lung, testis, thymus, intestine and uterus. and in bone marrow derived-macrophage and dendritic cells and mast cells. CD200R4 is involved in the recruitment or surface expression of the TYROBP receptor.

References

Wright, GJ. et al.,2003, J. Immunol. 171: 3034-46.

Gorczynski, R. et al., 2004,J. Immunol. 172:7744-7749.

Gorczynski, RM. et al.,2004, Am. J. Reprod. Immunol. 52:147-163.

Hatherley, D. et al.,2005. J. Immunol. 175: 2469-2474.

Catalog Number:MGB308-NO