Mouse CD200R4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGB308-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
813bp
Gene Synonym
MCD200RLa, F630107N04Rik, Cd200r4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD200 receptor 4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cell surface glycoprotein CD200 receptor 4, also known as Cell surface glycoprotein OX2 receptor 4, CD200 cell surface glycoprotein receptor-like 4, CD200RLa, and CD200R4, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200 (OX2) is a cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed mainly on myeloid cells and is involved in regulation of macrophage and mast cell function. In mouse there are up to five genes related to CD200R with conflicting data as to whether they bind CD200. CD200R4 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200R4 is highly expressed in monocytes, NK cells and a subset of NKT cells. It is weakly expressed in granulocytes and B cells (at protein level). CD200R4 is also expressed in brain, lung, testis, thymus, intestine and uterus. and in bone marrow derived-macrophage and dendritic cells and mast cells. CD200R4 is involved in the recruitment or surface expression of the TYROBP receptor.
References
  • Wright, GJ. et al.,2003, J. Immunol. 171: 3034-46.
  • Gorczynski, R. et al., 2004,J. Immunol. 172:7744-7749.
  • Gorczynski, RM. et al.,2004, Am. J. Reprod. Immunol. 52:147-163.
  • Hatherley, D. et al.,2005. J. Immunol. 175: 2469-2474.
  • TOP