Mouse Carboxypeptidase M/CPM Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_027468.1

RefSeq ORF Size

1332bp

Gene Synonym

AA589379, MGC118152, 1110060I01Rik, 5730456K23Rik, E030045M14Rik, Cpm

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse carboxypeptidase M Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.

References

Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.

Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.

Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.

Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.

Catalog Number:MGB112-NY