Mouse Carboxypeptidase M/CPM Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGB112-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1332bp
Gene Synonym
AA589379, MGC118152, 1110060I01Rik, 5730456K23Rik, E030045M14Rik, Cpm
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse carboxypeptidase M Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.
References
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
  • TOP