Mouse CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009793.3

RefSeq ORF Size

1410bp

Gene Synonym

CaMKIV, AI666733, CaMKIV/Gr, D18Bwg0362e, A430110E23Rik, Camk4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Ca²⁺/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca²⁺/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca²⁺/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca²⁺ and then apt to combine with the target protein. Ca²⁺/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

References

Feliciano DM, et al. (2009) Repression of Ca²⁺/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.

Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.

Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.

Catalog Number:MGB073-NY