Mouse CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB073-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1410bp
Gene Synonym
CaMKIV, AI666733, CaMKIV/Gr, D18Bwg0362e, A430110E23Rik, Camk4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.
References
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • TOP