Mouse Calsequestrin-1 / CASQ1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB069-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1200bp
Gene Synonym
CSQ; CSQ1; sCSQ; CSQ-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse calsequestrin 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium in the cisterna of the sarcoplasmic reticulum after a muscle contraction, even though the concentration of calcium in the sarcoplasmic reticulum is much higher than in the cytosol. Two forms of calsequestrin have been identified: Calsequestrin-2 and Calsequestrin-1. Calsequestrin-1 is found in fast skeletal muscle. The release of calsequestrin-bound calcium (through a calcium release channel) triggers muscle contraction. The active protein is not highly structured, more than 50% of it adopting a random coil conformation. When calcium binds there is a structural change whereby the alpha-helical content of the protein increases from 3 to 11%. Both forms of calsequestrin are phosphorylated by casein kinase 2, but the cardiac form is phosphorylated more rapidly and to a higher degree. Calsequestrin-1 is also secreted in the gut where it deprives bacteria of calcium ions.
References
  • Slupsky JR, et al. (1987) Characterization of cardiac calsequestrin. Biochemistry. 26(20): 6539-44.
  • Cala SE, et al. (1991) Phosphorylation of cardiac and skeletal muscle calsequestrin isoforms by casein kinase II. Demonstration of a cluster of unique rapidly phosphorylated sites in cardiac calsequestrin. J Biol Chem. 266(1):391-8.
  • Wang S, et al. (1998) Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol. 5(6):476-83.
  • TOP