Mouse Calsequestrin-1 / CASQ1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB069-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1200bp
Gene Synonym
CSQ; CSQ1; sCSQ; CSQ-1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse calsequestrin 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium in the cisterna of the sarcoplasmic reticulum after a muscle contraction, even though the concentration of calcium in the sarcoplasmic reticulum is much higher than in the cytosol. Two forms of calsequestrin have been identified: Calsequestrin-2 and Calsequestrin-1. Calsequestrin-1 is found in fast skeletal muscle. The release of calsequestrin-bound calcium (through a calcium release channel) triggers muscle contraction. The active protein is not highly structured, more than 50% of it adopting a random coil conformation. When calcium binds there is a structural change whereby the alpha-helical content of the protein increases from 3 to 11%. Both forms of calsequestrin are phosphorylated by casein kinase 2, but the cardiac form is phosphorylated more rapidly and to a higher degree. Calsequestrin-1 is also secreted in the gut where it deprives bacteria of calcium ions.
References
  • Slupsky JR, et al. (1987) Characterization of cardiac calsequestrin. Biochemistry. 26(20): 6539-44.
  • Cala SE, et al. (1991) Phosphorylation of cardiac and skeletal muscle calsequestrin isoforms by casein kinase II. Demonstration of a cluster of unique rapidly phosphorylated sites in cardiac calsequestrin. J Biol Chem. 266(1):391-8.
  • Wang S, et al. (1998) Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol. 5(6):476-83.
  • TOP