Human Cadherin-6/CDH6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC000019.2

RefSeq ORF Size

1992bp

Gene Synonym

CDH6, KCAD

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human cadherin 6, type 2, K-cadherin (fetal kidney) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

References

Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.

Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.

Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.

Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.

Catalog Number:MGB039-CY